seqan3::structure_file_input_default_traits_rna Struct Reference

The default traits for seqan3::structure_file_input. More...

#include <seqan3/io/structure_file/input.hpp>

Inheritance diagram for seqan3::structure_file_input_default_traits_rna:

Public Types
Member types
Definitions to satisfy seqan3::structure_file_input_traits.
using	seq_alphabet = rna5
	The sequence alphabet is seqan3::rna5.
using	seq_legal_alphabet = rna15
	The legal sequence alphabet for parsing is seqan3::rna15.
template<typename _seq_alphabet>
using	seq_container = std::vector<_seq_alphabet>
	The type of an RNA sequence is std::vector.
using	id_alphabet = char
	The alphabet for an identifier string is char.
template<typename _id_alphabet>
using	id_container = std::basic_string<_id_alphabet>
	The string type for an identifier is std::basic_string.
using	bpp_prob = double
	The type for a base pair probability is double.
using	bpp_partner = size_t
	The type for the partner position of a base pair probability is size_t.
template<typename _bpp_prob, typename _bpp_partner>
using	bpp_item = std::pair<_bpp_prob, _bpp_partner>
	The type of a base pair item is std::pair<double, size_t>.
template<typename _bpp_item>
using	bpp_queue = std::set<_bpp_item>
	A queue of base pair items sorted by probability is realised with std::set.
template<typename _bpp_queue>
using	bpp_container = std::vector<_bpp_queue>
	A string over all bases containing the respective interaction queues is represented as std::vector.
using	structure_alphabet = wuss51
	The alphabet for a structure annotation is seqan3::phred42.
template<typename _structure_alphabet>
using	structure_container = std::vector<_structure_alphabet>
	The string type for a structure annotation is std::vector.
template<typename _seq_alphabet, typename _structure_alphabet>
using	structured_seq_alphabet = structured_rna<_seq_alphabet, _structure_alphabet>
	The combined structured sequence alphabet is seqan3::structured_rna<seqan3::rna5, seqan3::wuss51>.
template<typename _structured_seq_alphabet>
using	structured_seq_container = std::vector<_structured_seq_alphabet>
	The type of a structured RNA sequence is std::vector.
using	energy_type = std::optional<double>
	The type of the energy is std::optional<double>.
using	react_type = double
	The type of the reactivity and reactivity error is double.
template<typename _react_type>
using	react_container = std::vector<_react_type>
	The type of a string of reactivity values is std::vector.
using	comment_alphabet = char
	The alphabet for a comment string is char.
template<typename _comment_alphabet>
using	comment_container = std::basic_string<_comment_alphabet>
	The string type for a comment is std::basic_string.
using	offset_type = size_t
	The type of the offset is size_t.

Additional Inherited Members
Related Symbols inherited from structure_file_input_traits
using	seq_alphabet
	Alphabet of the characters for the seqan3::field::seq; must satisfy seqan3::alphabet.
using	seq_legal_alphabet
	Intermediate alphabet for seqan3::field::seq; must satisfy seqan3::alphabet and be convertible to seq_alphabet.
using	seq_container
	Type template of the seqan3::field::seq, a container template over seq_alphabet; must satisfy seqan3::sequence_container.
using	id_alphabet
	Alphabet of the characters for the seqan3::field::id; must satisfy seqan3::alphabet.
using	id_container
	Type template of the seqan3::field::id, a container template over id_alphabet; must satisfy seqan3::sequence_container.
using	bpp_prob
	Data type for the base pair probabilities in seqan3::field::bpp; must satisfy std::is_floating_point.
using	bpp_partner
	Data type for the partner index of an interaction in seqan3::field::bpp; must satisfy std::numeric_limits::is_integer.
using	bpp_queue
	A container template representing a set of interactions of type bpp_item, which are (comparable) tuples of bpp_prob and bpp_partner; must satisfy seqan3::container and must provide a std::emplace(bpp_prob, bpp_partner) function.
using	bpp_container
	Type template of the seqan3::field::bpp, a container template over a set (bpp_queue) of interactions; must satisfy seqan3::sequence_container.
using	structure_alphabet
	Alphabet of the characters for the seqan3::field::structure; must satisfy seqan3::rna_structure_alphabet.
using	structure_container
	Type template of the seqan3::field::structure, a container template over structure_alphabet; must satisfy seqan3::sequence_container.
using	energy_type
	Type template of the seqan3::field::energy; must be std::optional of a type satisfying std::is_floating_point.
using	react_type
	Data type for the reactivity and reactivity error in seqan3::field::react and seqan3::field::react_err, respectively; must satisfy std::is_floating_point.
using	react_container
	Type template of the seqan3::field::react and seqan3::field::react_err, a container template over react_type; must satisfy seqan3::sequence_container.
using	comment_alphabet
	Alphabet of the characters for the seqan3::field::comment; must satisfy seqan3::alphabet.
using	comment_container
	Type template of the seqan3::field::comment, a container template over comment_alphabet; must satisfy seqan3::sequence_container.
using	offset_type
	Type template of the seqan3::field::offset; must statisfy std::numeric_limits::is_integer.

Detailed Description

The default traits for seqan3::structure_file_input.

If you wish to change a single or a few types from the default, just inherit from this class and "overwrite" the respective type definitions.

This example will make the file read into a smaller alphabet:

// SPDX-FileCopyrightText: 2006-2025 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2025 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
 
#include <sstream>
 
#include <seqan3/alphabet/nucleotide/rna4.hpp>
#include <seqan3/core/debug_stream.hpp>
#include <seqan3/io/structure_file/input.hpp>
 
// Define custom traits
struct my_traits : seqan3::structure_file_input_default_traits_rna
{
    using seq_alphabet = seqan3::rna4; // instead of rna5
};
 
auto input = R"(> S.cerevisiae_tRNA-PHE M10740/1-73
GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUUUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCA
(((((((..((((........)))).((((.........)))).....(((((.......)))))))))))). (-17.50)
> example
UUGGAGUACACAACCUGUACACUCUUUC
..(((((..(((...)))..)))))... (-3.71))";
 
int main()
{
    seqan3::structure_file_input<my_traits> fin{std::istringstream{input}, seqan3::format_vienna{}};
}

---

The documentation for this struct was generated from the following file:

• structure_file/input.hpp